More Than Just a Meme – How We Traced Our Maternal Lineage Using Our Mitochondria (Part 2)

If you haven’t already, check out
In More Than Just A Meme Part 1 – The Secrets Behind the Infamous Mitochondria
where we discussed what the mitochondria was, how it came to live inside our cells and how it keeps track of our maternal lineage. In this piece, we are going to get into the nitty-gritty of how we traced our maternal ancestry using our mitochondrial DNA (mtDNA).

By A.K. Matai

Over time, different human populations have picked up different mutations in a small sequence of mitochondrial DNA called the control region (also called the hypervariable region). Because this site doesn’t have any biological functions, mutations were free to accumulate there, with no adverse effects on our health or survival. This makes it the perfect site for mapping out human ancestry. By identifying which series of mutations we have, we can determine our mitochondrial haplogroup (ie. where our maternal lineage traces back). But just sequencing our hypervariable region isn’t enough. To identify what is and isn’t a mutation, we need to be able to compare it to a normal sequence. For mitochondrial DNA, scientists use the Cambridge Reference Sequence (CRS), which was originally obtained in the 1970s from a woman of European descent. Her sequence is in no way more “normal” or “original” than anyone else’s, but it serves as a reference point for our sequence comparisons. And in truth, there’s no possible way of identifying what the “original” sequence was without traveling back in time 1.8 million years to watch our own evolution. Until someone events a time machine, the Cambridge Reference Sequence will just have to do.

migration_map_wfn(1)
Mitochondrial haplogroups are denoted here as single alphabetical letters with or without a number. Each haplogroup details an ethnic group and their migration out of Africa. Image obtained from world families.net. 

How We Actually Did It…

mtdna-2-e1498666536183.jpg
Materials we used to sequence our own mitochondrial DNA: sterile toothpicks, an ice bucket, 0.2M NaOH, 0.1M Tris-HCl pH 7.5, DNA primers for PCR amplification and sequencing, PCR machine / thermocycler (including polymerase, dNTPs and appropriate buffers), PCR cleanup kit (to purify our amplified mitochondrial DNA), and a Nanodrop (to determine the concentration of our purified DNA).

We started off by collecting our own mtDNA by using sterile toothpicks to scrape off a some cells from the sides of our cheeks. These cell were then suspended in solution by swishing our toothpicks in 30uL of 0.2M NaOH. The solution was then incubated at 70°C for ~10 minutes. This helps break up the membranes of the cells to release our mitochondrial DNA. After incubation, the solution was neutralized with 110uL of 0.1M Tris-HCl pH7.5. We used only 3uL of the neutralized solution containing our DNA for the amplification step.

mtDNA (7)
The amplified and sequenced the control region of our mitochondrial DNA using DNA primer, their sequence are:
F1 – 5′ CTCCACCATTAGCACCCAAA 3′
F2 – 5’ AAGCCTAAATAGCCCACACG 3’ 
R1 – 5′ GATGTGAGCCCGTCTAAACA 3′
R2 – 5’ AGAGCTCCCGTGAGTGGTTA 3’ 
We had them synthesized for us by IDT for ~$5 each

We amplified the control region of our mitochondrial DNA by polymerase chain reaction (PCR), using DNA primers with the Platinum Pfx DNA polymerase by Invitrogen.

mtDNA (5)
Our thermocycler for PCR. We used an annealing temperature of  52°C and an elongation time of 1 minute and 24 seconds. 30 cycles were used to amplify our DNA.

After amplification was complete, the DNA was cleaned up using QIAGEN’s PCR clean up kit. A small amount of that product was ran on a polyacrylamide gel to ensure that we had our desired 1230 base pair (bp) product.

mtDNA (8)
Results from our agarose gel electrophoresis confirms the size of our PCR products. We amplified DNA from 3 different participants

After we confirmed that we had our desired PCR product, we determined the concentration of our purified DNA using a standard spectrophotometer (Thermoscientific’s Nanodrop 2000/2000c ) before finally sending 225 ng of DNA to a sequencing facility.

Screen Shot 2017-06-19 at 2.42.54 PM
Typical electropherogram containing our sequencing results. We used Finch TV to analyze our the data.

Once we got our sequencing results back, all that was left was to compare these sequences with the Cambridge Reference Sequence and determine which haplotypes we belonged to. Rather than comparing them and circling the differences by hand, we utilized a free online program called mtDNA Profiler to do the work for us.

We copied our sequence results from Finch TV and pasted it into the mtDNA profiler tool.

Screen Shot 2017-06-19 at 4.44.24 PM.png
Image of the mtDNA profiler website. We’ve copy pasted our DNA sequence from FinchTV directly into the window and added the term “>SampleSequence” one line above it to fit the FASTA formatting requirements.

Once you’ve hit “execute” you should get something like this.

Screen Shot 2017-06-19 at 4.55.32 PM.png
Sample mtDNA profiler results.

The results show some basic information such as which insertion or deletion mutations you might have and their location in your sequence. For our Sample Sequence, we have the profile “16126C 16150T 16223T 16519C 73G 263G 315.1C 482C 489C”.

That information was copied into the mtDNA Manager to finally obtain our haplogroups.

Screen Shot 2017-06-19 at 4.59.50 PM
Copy / paste the profile into the mtDNA Manager

Once the search option is filled out properly, we went ahead and hit “search”.

Screen Shot 2017-06-19 at 5.02.27 PM.png
For our sample sequence, we got the estimated haplogroup as M3.

At long last, we arrive at our haplogroup (Estimated HG) for our Sample Sequence. At this point, a quick Google search should tell you where your maternal lineage traces back. For our sample sequence, the haplogroup M3 traces back to South Asia, and is most commonly found in people from west and northwest India.

Stay tuned for Part 3 of our More Than Just a Meme series, where we reveal the results our own sequencing analysis. How well do we really know our own ancestry? And what other shocking secrets might we discover? The answers will surprise you.

Advertisements

2 Comments

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s